si:dkey-205h13.2

Ensembl ID:
ENSDARG00000089429
ZFIN ID:
ZDB-GENE-080225-18
Human Orthologues:
CILP, CILP2
Human Descriptions:
cartilage intermediate layer protein 2 [Source:HGNC Symbol;Acc:24213]
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase [Source:HGNC Symbol;Acc:1980]
Mouse Orthologues:
Cilp, Cilp2
Mouse Descriptions:
cartilage intermediate layer protein 2 Gene [Source:MGI Symbol;Acc:MGI:1915959]
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29939 Nonsense Mutation detected in F1 DNA During 2017
sa43992 Nonsense Mutation detected in F1 DNA During 2017
sa11380 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29939
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124811   None 308 None 7
ENSDART00000135988 Nonsense 267 384 10 12
Genomic Location (Zv9):
Chromosome 23 (position 26772999)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26605821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTCTAGTTATTGCCTTAATTCATGCTTTAAATGTGTTTTTGAAGGTA[T/G]AATCCAACAGTTGGGTTTTCCTGTGTAAACGCAAACCAAGCATCAGGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124811 Nonsense 196 308 5 7
ENSDART00000135988   None 384 None 12
Genomic Location (Zv9):
Chromosome 23 (position 26767413)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26600235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATGTGCTGATTATAAGGTGCGCTTCACCTGTCCAGAGGAATGGTGTT[C/A]AAGTGAGTTCACCCGATGTCATGATAACACTAATTGATTTAATTAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124811 Nonsense 253 308 6 7
ENSDART00000135988   None 384 None 12
Genomic Location (Zv9):
Chromosome 23 (position 26767020)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26599842
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTWTCAACYATTACCGGGACTCCTGTACYGCCAACTGGAAACCATTTT[C/T]AAACGTAAGATTTAAGAATACTTCTTTTAGGGCTGTTAAAYGATACAMAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Triglycerides: Biological, clinical and population relevance of 95 loci for blood lipids. (View Study)
  • Triglycerides: Common variants at 30 loci contribute to polygenic dyslipidemia. (View Study)
  • Triglycerides: Genetic variants influencing circulating lipid levels and risk of coronary artery disease. (View Study)
  • Triglycerides: Newly identified loci that influence lipid concentrations and risk of coronary artery disease. (View Study)
  • Triglycerides: Six new loci associated with blood low-density lipoprotein cholesterol, high-density lipoprotein cholesterol or triglycerides in humans. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link