nop10

Ensembl ID:
ENSDARG00000089426
ZFIN ID:
ZDB-GENE-041007-4
Description:
H/ACA ribonucleoprotein complex subunit 3 [Source:UniProtKB/Swiss-Prot;Acc:Q6DRH5]
Human Orthologues:
AC011611.1, NOP10
Human Description:
NOP10 ribonucleoprotein homolog (yeast) [Source:HGNC Symbol;Acc:14378]
Mouse Orthologue:
Nop10
Mouse Description:
NOP10 ribonucleoprotein homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1913431]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11074 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130241 Nonsense 34 64 2 2
Genomic Location (Zv9):
Chromosome 7 (position 1601796)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 1372458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGAAAGTGGACCCCAGTGGTCAGCCCACCAGCTCKGCTCATCCGGCC[C/T]GATTCTCACCCGACGACAAGTTCTCCAGGCACCGAGTGACCATCAAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link