ENSDARG00000089423

Ensembl ID:
ENSDARG00000089423

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40182 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20155 Nonsense Available for shipment Available now
sa20156 Nonsense Available for shipment Available now
sa20157 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124332 Essential Splice Site 393 1217 10 28
Genomic Location (Zv9):
Chromosome 3 (position 57272021)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150450.1 21568
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTATTTTTGCTGTAGGCATCCAAATTTAAACCCATTTATGTTCTGGAAA[A/T]TATTTTTGTGATTTTTGACATTGTTGAATTTTGTTTTAATTGTTTTAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124332 Nonsense 677 1217 20 28
Genomic Location (Zv9):
Chromosome 3 (position 57280497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAACGTGCATGCAATGTATACATACTTTTTTTAAACAGACTAAATCT[G/T]AGTGGAAACTTATTGAGAGATTCAATAAATTCCGGATAAACTGGAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124332 Nonsense 727 1217 20 28
Genomic Location (Zv9):
Chromosome 3 (position 57280648)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56669428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAACCTATCTTGAGGAAGAAGAAGCTGTTCTCAAACATCTTTTAGGCT[G/A]GGCAGCAGCTAAGAACATATTTCAGCTCCATGGTAGTTATTTGATTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124332 Nonsense 998 1217 23 28
Genomic Location (Zv9):
Chromosome 3 (position 57281731)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 56670528
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGGCAGCAGAAGTTGCGATCATGAGCAAACAAGACTTCAATGATGAC[C/T]AACGCTGGGTCCAGACAAGAATCCAGCAGATCAAGCAGTACCATGAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link