ENSDARG00000089423

Ensembl ID:
ENSDARG00000089423

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20155 Nonsense Mutation detected in F1 DNA During 2014
sa20156 Nonsense Mutation detected in F1 DNA During 2014
sa20157 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124332 Nonsense 677 1217 20 28
Genomic Location:
Chromosome 3 (position 57280497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAACGTGCATGCAATGTATACATACTTTTTTTAAACAGACTAAATCT[G/T]AGTGGAAACTTATTGAGAGATTCAATAAATTCCGGATAAACTGGAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124332 Nonsense 727 1217 20 28
Genomic Location:
Chromosome 3 (position 57280648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAACCTATCTTGAGGAAGAAGAAGCTGTTCTCAAACATCTTTTAGGCT[G/A]GGCAGCAGCTAAGAACATATTTCAGCTCCATGGTAGTTATTTGATTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124332 Nonsense 998 1217 23 28
Genomic Location:
Chromosome 3 (position 57281731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGGCAGCAGAAGTTGCGATCATGAGCAAACAAGACTTCAATGATGAC[C/T]AACGCTGGGTCCAGACAAGAATCCAGCAGATCAAGCAGTACCATGAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1g4zugng