LOC100330675

Ensembl ID:
ENSDARG00000089422
Human Orthologue:
CEP164
Human Description:
centrosomal protein 164kDa [Source:HGNC Symbol;Acc:29182]
Mouse Orthologue:
Cep164
Mouse Description:
centrosomal protein 164 Gene [Source:MGI Symbol;Acc:MGI:2384878]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22733 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128191 Essential Splice Site 66 106 2 3
Genomic Location:
Chromosome 15 (position 46555690)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCAGGGAGGGGATGGTGGCGCCGCTACCGGCAGAGTGGAAACCATGG[T/G]AACACACACTCCACAACACACCATAGATATGTACACTAGATATCGCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dcn54drx