LOC100332699

Ensembl ID:
ENSDARG00000089416
Human Orthologues:
HDAC4, HDAC5, HDAC7, HDAC9
Human Descriptions:
histone deacetylase 4 [Source:HGNC Symbol;Acc:14063]
histone deacetylase 5 [Source:HGNC Symbol;Acc:14068]
histone deacetylase 7 [Source:HGNC Symbol;Acc:14067]
histone deacetylase 9 [Source:HGNC Symbol;Acc:14065]
Mouse Orthologues:
Hdac4, Hdac5, Hdac7, Hdac9
Mouse Descriptions:
histone deacetylase 4 Gene [Source:MGI Symbol;Acc:MGI:3036234]
histone deacetylase 5 Gene [Source:MGI Symbol;Acc:MGI:1333784]
histone deacetylase 7 Gene [Source:MGI Symbol;Acc:MGI:1891835]
histone deacetylase 9 Gene [Source:MGI Symbol;Acc:MGI:1931221]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25078 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25078
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126293 Essential Splice Site 31 167 1 3
Genomic Location:
Chromosome 19 (position 2256725)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTGGAGGAGGAGAAGCCTGGACTCCAACAGCACAGCCGGCACTACAGG[T/C]ACACACACACACACACACACACACACACACACACACACACACACACTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rfjfbf2e