ASTN2 (1 of 3)

Ensembl ID:
ENSDARG00000089410
Description:
astrotactin 2 [Source:HGNC Symbol;Acc:17021]
Human Orthologue:
ASTN2
Human Description:
astrotactin 2 [Source:HGNC Symbol;Acc:17021]
Mouse Orthologue:
Astn2
Mouse Description:
astrotactin 2 Gene [Source:MGI Symbol;Acc:MGI:1889277]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24782 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24782
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126539 Nonsense 116 129 3 3
Genomic Location (Zv9):
Chromosome Zv9_NA154 (position 19513)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149782.1 19513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACCTGCAACATCTACTTCCCCAGCAAGAAGTCCCAGCAGCAGCTCTG[G/A]CTCCAGTACCAGAAAGGTAGGAGAATGGAGAGATCGGGGGATCCTCGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link