LOC796940

Ensembl ID:
ENSDARG00000089406
Human Orthologue:
ZFP37
Human Description:
zinc finger protein 37 homolog (mouse) [Source:HGNC Symbol;Acc:12863]
Mouse Orthologue:
Zfp37
Mouse Description:
zinc finger protein 37 Gene [Source:MGI Symbol;Acc:MGI:99181]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24740 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125166 Nonsense 388 421 2 2
Genomic Location:
Chromosome Zv9_scaffold3462 (position 88783)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCACACGGAAAGACTCCATTAAGAAACACATGAAGATGCACTCAAGA[G/T]AGGATCCTTTTAGATGCAGTGAATGTGGAAAGGGCTTTAAAAGTAAAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yjnh0lme