ftr37

Ensembl ID:
ENSDARG00000089388
ZFIN ID:
ZDB-GENE-070912-486
Description:
Novel protein similar to H.sapiens tripartite motif-containing [Source:UniProtKB/TrEMBL;Acc:B0S6J1]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11616 Nonsense Available for shipment Available now
sa19917 Essential Splice Site Mutation detected in F1 DNA During 2016
sa31305 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061172 Nonsense 174 199 1 2
ENSDART00000100987 Nonsense 174 557 1 6
ENSDART00000134662 Nonsense 174 506 1 6
Genomic Location (Zv9):
Chromosome 2 (position 60171335)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59248126
KASP Assay ID:
2259-2850.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GARAAACCCCTGGAGATCTTCTGCCGCACTGATCAGCKATGTATATGTTA[T/A]CTKTGTACAATGGATCAACACAAAAACCACAAYACTGTTTYAGCTGYWGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061172   None 199 None 2
ENSDART00000100987   None 557 None 6
ENSDART00000134662 Essential Splice Site 360 506 4 6
Genomic Location (Zv9):
Chromosome 2 (position 60167466)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59244257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTGGAGCATTTCGGCAAAAAGGAGATAAAGTTGATTTCTAGAAGAG[G/A]TCAGATTTATATTTCCTGACATGTTTCAGATGATTTTAAATGTATTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061172   None 199 None 2
ENSDART00000100987 Nonsense 473 557 6 6
ENSDART00000134662   None 506 None 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 60071325)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59148116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCAGCAGGAAGGGTTCGGGTAATGAGTGTGGATTTGGACGCAATGAT[C/T]AGTCCTGGAGTTTGGAGTACTCTTCTCACAGTTTCTCATTCTATCATAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link