ftr37

Ensembl ID:
ENSDARG00000089388
ZFIN ID:
ZDB-GENE-070912-486
Description:
Novel protein similar to H.sapiens tripartite motif-containing [Source:UniProtKB/TrEMBL;Acc:B0S6J1]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11616 Nonsense Available for shipment Available now
sa19917 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061172 Nonsense 174 199 1 2
ENSDART00000100987 Nonsense 174 557 1 6
ENSDART00000134662 Nonsense 174 506 1 6
Genomic Location:
Chromosome 2 (position 60171335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GARAAACCCCTGGAGATCTTCTGCCGCACTGATCAGCKATGTATATGTTA[T/A]CTKTGTACAATGGATCAACACAAAAACCACAAYACTGTTTYAGCTGYWGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19917
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061172 None None 199 None 2
ENSDART00000100987 None None 557 None 6
ENSDART00000134662 Essential Splice Site 360 506 4 6
Genomic Location:
Chromosome 2 (position 60167466)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTGGAGCATTTCGGCAAAAAGGAGATAAAGTTGATTTCTAGAAGAG[G/A]TCAGATTTATATTTCCTGACATGTTTCAGATGATTTTAAATGTATTTGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b6oyvfyz