LOC557541

Ensembl ID:
ENSDARG00000089383

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7672 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16990 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127049 Essential Splice Site 5 356 2 7
Genomic Location:
Chromosome 11 (position 30841521)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTTGAAAAYGTATCCATTTGAAAACATTTGACGTGTGGCTTTTTCT[A/T]GGGAAGTCCAGTTTGTGGTGGGGTTAAGCTGTTCCACACTGAATGTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127049 Nonsense 137 356 4 7
Genomic Location:
Chromosome 11 (position 30843786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAGATTCAGAGTGCGAAGATGAAATYGAAGRCAAGCTTTWCAGTGAC[A/T]AAAATCTGCTGATTGTCTCCATGGAAGATGCRAGCTTCAAYATGGTTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xa4k8e5n