LOC100334411

Ensembl ID:
ENSDARG00000089377
Human Orthologues:
CD207, CD209, CLEC4F, CLEC4M, FCER2
Human Descriptions:
C-type lectin domain family 4, member F [Source:HGNC Symbol;Acc:25357]
C-type lectin domain family 4, member M [Source:HGNC Symbol;Acc:13523]
CD207 molecule, langerin [Source:HGNC Symbol;Acc:17935]
CD209 molecule [Source:HGNC Symbol;Acc:1641]
Fc fragment of IgE, low affinity II, receptor for (CD23) [Source:HGNC Symbol;Acc:3612]
Mouse Orthologues:
Cd207, Cd209a, Cd209b, Cd209c, Cd209d, Cd209e, Cd209f, Cd209g, Clec4f, Fcer2a
Mouse Descriptions:
C-type lectin domain family 4, member f Gene [Source:MGI Symbol;Acc:MGI:1859834]
CD207 antigen Gene [Source:MGI Symbol;Acc:MGI:2180021]
CD209a antigen Gene [Source:MGI Symbol;Acc:MGI:2157942]
CD209b antigen Gene [Source:MGI Symbol;Acc:MGI:1916415]
CD209c antigen Gene [Source:MGI Symbol;Acc:MGI:2157945]
CD209d antigen Gene [Source:MGI Symbol;Acc:MGI:2157947]
CD209e antigen Gene [Source:MGI Symbol;Acc:MGI:2157948]
CD209f antigen Gene [Source:MGI Symbol;Acc:MGI:1916392]
CD209g antigen Gene [Source:MGI Symbol;Acc:MGI:1917442]
Fc receptor, IgE, low affinity II, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:95497]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17543 Nonsense Available for shipment Available now
sa17947 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17543
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125730 Nonsense 32 225 2 7
Genomic Location:
Chromosome 3 (position 39202668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTATAAGCACTTATATTTACATATGCAGRGTGTAASTGTAAACCAATG[C/T]AGAGGAAATTATCCTGTCTTCTCTTCCTGTCTTWGCTGGCAAATGGGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125730 Nonsense 43 225 2 7
Genomic Location:
Chromosome 3 (position 39202634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAASTGTAAACCAATGYAGAGGAAATTATCCTGTCTTCTCTTCCTGTCTT[T/A]GCTGGCAAATGGGGGGTTGGCATATCTGTGTGAGTTCTATTTTATATTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5nxx9kmd