ENSDARG00000089372

Ensembl ID:
ENSDARG00000089372
Human Orthologues:
CLK1, CLK4
Human Descriptions:
CDC-like kinase 1 [Source:HGNC Symbol;Acc:2068]
CDC-like kinase 4 [Source:HGNC Symbol;Acc:13659]
Mouse Orthologues:
Clk1, Clk4
Mouse Descriptions:
CDC like kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1098551]
CDC-like kinase 1 Gene [Source:MGI Symbol;Acc:MGI:107403]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18134 Nonsense Available for shipment Available now
sa13266 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126279 Nonsense 154 504 3 12
Genomic Location:
Chromosome 14 (position 6906188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGGTGATGGCGGTGTTCCGAAACCTCAGAGGAGCCATCGCAGGAAA[A/T]GAWCCAGGAGTGTTGAGGATGATGAGGAGGGGCACCTGGTCTATCACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126279 Nonsense 266 504 6 12
Genomic Location:
Chromosome 14 (position 6902239)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACCACGGGCACATCTGCATTGCCTTTGAGCTGCTGGGCTTGAGCACGTA[T/A]GATTTTCTGAAGGAAAATAACTTTCAGCCCTTCTATATCAACCAYATCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n2439f7r