LOC100329612

Ensembl ID:
ENSDARG00000089367
Human Orthologues:
PRRT2, TMEM233
Human Descriptions:
proline-rich transmembrane protein 2 [Source:HGNC Symbol;Acc:30500]
transmembrane protein 233 [Source:HGNC Symbol;Acc:37219]
Mouse Orthologues:
Prrt2, Tmem233
Mouse Descriptions:
proline-rich transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:1916267]
transmembrane protein 233 Gene [Source:MGI Symbol;Acc:MGI:3651514]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22019 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125427 Essential Splice Site 178 226 2 4
Genomic Location:
Chromosome 12 (position 5767118)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCCCGTCTGGCCCATCAACATTGTGGGATTTGTTTACTCCATCATG[G/A]TAGGTAGAAACTGGGCCTTTTGGGTCATTCTCTACTATCTTATGCTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gfit0uhs