ENSDARG00000089358

Ensembl ID:
ENSDARG00000089358
Human Orthologues:
MUC17, MUC5B
Human Descriptions:
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25674 Nonsense Mutation detected in F1 DNA During 2015
sa25675 Nonsense Mutation detected in F1 DNA During 2015
sa19600 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa25674
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128834 Nonsense 509 5002 4 16
Genomic Location:
Chromosome 1 (position 52843507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAGAAACATCTGCCAAAACGACAGAGCTCTTAACAACAACTCCTACT[G/T]AAATATCAACCACTGCTATCGAAGAAACATCTACTGCAACATCAGAGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25675
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128834 Nonsense 1743 5002 10 16
Genomic Location:
Chromosome 1 (position 52851642)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACAACAACTCTTGCTGAAGAATCCACCAGTACGGCAGTAGTAACATCT[A/T]AAATAACAACATCAACTACAACAACAGAGCCTTCGACAACCACTCCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128834 Nonsense 3633 5002 16 16
Genomic Location:
Chromosome 1 (position 52862583)
KASP Assay ID:
2259-1151.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGAAACATCTACTATAAATACAGAGCCCTCCACAACAACTCCTGCT[G/T]AAACATCTTCCACTGCTGCAGAAGAAACATCTACTACAACAGAGGCCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hhyichoc