ENSDARG00000089358

Ensembl ID:
ENSDARG00000089358
Human Orthologues:
MUC17, MUC5B
Human Descriptions:
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19600 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128834 Nonsense 3633 5002 16 16
Genomic Location:
Chromosome 1 (position 52862583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGAAACATCTACTATAAATACAGAGCCCTCCACAACAACTCCTGCT[G/T]AAACATCTTCCACTGCTGCAGAAGAAACATCTACTACAACAGAGGCCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hhyichoc