C19orf26 (2 of 2)

Ensembl ID:
ENSDARG00000089348
Description:
chromosome 19 open reading frame 26 [Source:HGNC Symbol;Acc:28617]
Human Orthologue:
C19orf26
Human Description:
chromosome 19 open reading frame 26 [Source:HGNC Symbol;Acc:28617]
Mouse Orthologue:
Dos
Mouse Description:
downstream of Stk11 Gene [Source:MGI Symbol;Acc:MGI:1354170]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18348 Nonsense Available for shipment Available now
sa19916 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122394 Nonsense 188 631 3 3
Genomic Location:
Chromosome 2 (position 59909389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGGCTGGAGCATCAGGAGGMGGTGGGGAGGAGTTTGKASCCATGGGT[C/T]AGTTGGARAGCCTGGATCAGCCCAGTCTGTACCGTGATATCTGGAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122394 Nonsense 312 631 3 3
Genomic Location:
Chromosome 2 (position 59909017)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGGCTACGCCTCGATTGAAGCTCCATGCAAAGCTCCAGAGGAACTC[A/T]GACTATTCGGAAGCGGCTCTGGAAAGACAGCGTCTGAGCGACGCCGCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mhmuowmp