rhobtb2b

Ensembl ID:
ENSDARG00000089340
ZFIN ID:
ZDB-GENE-071125-1
Human Orthologue:
RHOBTB2
Human Description:
Rho-related BTB domain containing 2 [Source:HGNC Symbol;Acc:18756]
Mouse Orthologue:
Rhobtb2
Mouse Description:
Rho-related BTB domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2180557]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6184 Nonsense Mutation detected in F1 DNA During 2014
sa21813 Nonsense Available for shipment Available now
sa11339 Nonsense Available for shipment Available now
sa16708 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6184
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123496 Nonsense 418 714 6 11
Genomic Location:
Chromosome 10 (position 44070102)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTGGATCCCTCAGTGCTGYTTGGGCCGTTTGCTGTGGTCCTGCGCTA[T/A]CTCTATACGGGACGGCTGGATGAAAATGAAAAGGAWTTGATGCACATTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123496 Nonsense 479 714 6 11
Genomic Location:
Chromosome 10 (position 44070285)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATCACAAAGGCTTTCCATGTGCGACGCACCAATCGGGTGAAGGAGTG[C/A]TTGGCTAAAGGAACCTTCTCAGGTTGGAGTTTTGTTACTGTGATGCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123496 Nonsense 601 714 9 11
Genomic Location:
Chromosome 10 (position 44077992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGARAGCGCTGCRGCGGGCACAGACATTGATGGAGACGTGCTGCTGTA[T/A]CTAGAGATGGCTCAGGTAMAAATACAACTGCAAACTNNNNNNNNNNNNNN
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123496 Nonsense 699 714 11 11
Genomic Location:
Chromosome 10 (position 44080144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAGGAGGAGGTGGACCCTGAGGAGCATACAGAGCCCTGMGCCGCCAT[C/A]ATCACCTTCATCATCACCATCATCATCAGGCTCMTCTGCTATCATCTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/p71jjmmw