si:ch211-198c19.1

Ensembl ID:
ENSDARG00000089333
ZFIN ID:
ZDB-GENE-100922-218

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9047 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124433 Nonsense 86 164 1 1
ENSDART00000140148 Nonsense 86 164 2 2
Genomic Location (Zv9):
Chromosome 16 (position 40543922)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37928722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCATAATGAAGGGAACCTGCTCCCTCCATTGAAGGACAAACACACGTA[T/A]AAATACTTCACTATAGGAAACCTTCACTACCGGCACTCTGAGGATCTCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link