arhgap20

Ensembl ID:
ENSDARG00000089326
ZFIN ID:
ZDB-GENE-071015-1
Human Orthologue:
ARHGAP20
Human Description:
Rho GTPase activating protein 20 [Source:HGNC Symbol;Acc:18357]
Mouse Orthologues:
1700006A11Rik, Arhgap20, Gm1527
Mouse Descriptions:
predicted gene 1527 Gene [Source:MGI Symbol;Acc:MGI:2686373]
Rho GTPase activating protein 20 Gene [Source:MGI Symbol;Acc:MGI:2445175]
RIKEN cDNA 1700006A11 gene Gene [Source:MGI Symbol;Acc:MGI:1919074]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41438 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41437 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130317 Essential Splice Site 25 907 1 15

The following transcripts of ENSDARG00000089326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30577757)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29733703
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGAAGAGGAGCCGAACCAAAAGTTGTGGGGAATATCATCTCTCCAAT[G/A]TAAGTAAAGCAATGCTAATGGATGATAAACAACATAACGTCATCATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130317 Nonsense 222 907 7 15

The following transcripts of ENSDARG00000089326 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30571559)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29727505
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCAGCAACACAGATTGTACATCTGATGTCATTAGCACAGCACTGCAA[C/T]AGTTTGGTCTTTCGGTAAGTTTAGATTGCACAACAACAACAACAACAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link