arhgap20

Ensembl ID:
ENSDARG00000089326
ZFIN ID:
ZDB-GENE-071015-1
Human Orthologue:
ARHGAP20
Human Description:
Rho GTPase activating protein 20 [Source:HGNC Symbol;Acc:18357]
Mouse Orthologues:
1700006A11Rik, Arhgap20, Gm1527
Mouse Descriptions:
predicted gene 1527 Gene [Source:MGI Symbol;Acc:MGI:2686373]
Rho GTPase activating protein 20 Gene [Source:MGI Symbol;Acc:MGI:2445175]
RIKEN cDNA 1700006A11 gene Gene [Source:MGI Symbol;Acc:MGI:1919074]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41438 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41437 Nonsense Mutation detected in F1 DNA During 2016
sa5546 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130317 Essential Splice Site 25 907 1 15

The following transcripts of ENSDARG00000089326 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 30577757)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGAAGAGGAGCCGAACCAAAAGTTGTGGGGAATATCATCTCTCCAAT[G/A]TAAGTAAAGCAATGCTAATGGATGATAAACAACATAACGTCATCATAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130317 Nonsense 222 907 7 15

The following transcripts of ENSDARG00000089326 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 30571559)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCAGCAACACAGATTGTACATCTGATGTCATTAGCACAGCACTGCAA[C/T]AGTTTGGTCTTTCGGTAAGTTTAGATTGCACAACAACAACAACAACAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130317 Nonsense 398 907 11 15

The following transcripts of ENSDARG00000089326 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 30568641)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTGAAGGCCTGTCGAGAGCTGAAGGAAAAACTGGATTCTGGCCACTA[C/A]GAGGAACCGCTGACTGGAGAATCTGTACTAGTTACTGCTGCAGTGTTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link