LOC557896

Ensembl ID:
ENSDARG00000089320
Human Orthologue:
C14orf38
Human Description:
chromosome 14 open reading frame 38 [Source:HGNC Symbol;Acc:19847]
Mouse Orthologue:
4930403N07Rik
Mouse Description:
RIKEN cDNA 4930403N07 gene Gene [Source:MGI Symbol;Acc:MGI:1921186]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36353 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125212 Essential Splice Site 16 631 2 16
Genomic Location (Zv9):
Chromosome 17 (position 14303455)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 14420555
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATAACATGACAAGTGATACAATGAAACCTATGTCTGTTATATTTCA[G/A]TCAGGGGAGAGAAAACATTACAAGAAACTATGAAGATGCTGTTGATCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link