ENSDARG00000089319

Ensembl ID:
ENSDARG00000089319
Human Orthologues:
ANKK1, RIPK1, RIPK3, RIPK4
Human Descriptions:
ankyrin repeat and kinase domain containing 1 [Source:HGNC Symbol;Acc:21027]
receptor (TNFRSF)-interacting serine-threonine kinase 1 [Source:HGNC Symbol;Acc:10019]
receptor-interacting serine-threonine kinase 3 [Source:HGNC Symbol;Acc:10021]
receptor-interacting serine-threonine kinase 4 [Source:HGNC Symbol;Acc:496]
Mouse Orthologues:
Ankk1, Ripk1, Ripk3, Ripk4
Mouse Descriptions:
ankyrin repeat and kinase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3045301]
receptor (TNFRSF)-interacting serine-threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:108212]
receptor-interacting serine-threonine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2154952]
receptor-interacting serine-threonine kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1919638]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8769 Nonsense Mutation detected in F1 DNA During 2016
sa8480 Nonsense Mutation detected in F1 DNA During 2016
sa34083 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130097 Nonsense 29 513 1 11
Genomic Location (Zv9):
Chromosome 7 (position 29994306)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28386829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGACCTGCGAGATGTAGTTCTGGTGAGAACGAGCGTAGGCGCCTGTT[T/A]GCGAGGACATTTCGGGAGAACTGGRGGCAAAGTGGCTGTCAAGTTAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130097 Nonsense 60 513 2 11
Genomic Location (Zv9):
Chromosome 7 (position 29993839)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28386362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNTTCTTTTCAGTAAATGGATTGACAGGTTAAAGAGAGCAGGGATGT[T/A]GGRGCAGGTGTGTTGCGAGCAAGTACTCRTCCCGCTGGGTGTGTGCMMAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130097 Nonsense 85 513 2 11
Genomic Location (Zv9):
Chromosome 7 (position 29993764)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28386287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCATCCCGCTGGGTGTGTGCACATCACACTCTCTAGTTGGTCTGGTTT[G/A]GGATTGGATGCCTGAAGGATCTCTAGATTCTCTGCTGCATGAGGTAAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link