ENSDARG00000089319

Ensembl ID:
ENSDARG00000089319
Human Orthologues:
ANKK1, RIPK1, RIPK3, RIPK4
Human Descriptions:
ankyrin repeat and kinase domain containing 1 [Source:HGNC Symbol;Acc:21027]
receptor (TNFRSF)-interacting serine-threonine kinase 1 [Source:HGNC Symbol;Acc:10019]
receptor-interacting serine-threonine kinase 3 [Source:HGNC Symbol;Acc:10021]
receptor-interacting serine-threonine kinase 4 [Source:HGNC Symbol;Acc:496]
Mouse Orthologues:
Ankk1, Ripk1, Ripk3, Ripk4
Mouse Descriptions:
ankyrin repeat and kinase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3045301]
receptor (TNFRSF)-interacting serine-threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:108212]
receptor-interacting serine-threonine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2154952]
receptor-interacting serine-threonine kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1919638]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8769 Nonsense Mutation detected in F1 DNA During 2014
sa8480 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130097 Nonsense 29 513 1 11
Genomic Location:
Chromosome 7 (position 29994306)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGACCTGCGAGATGTAGTTCTGGTGAGAACGAGCGTAGGCGCCTGTT[T/A]GCGAGGACATTTCGGGAGAACTGGRGGCAAAGTGGCTGTCAAGTTAATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8480
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130097 Nonsense 60 513 2 11
Genomic Location:
Chromosome 7 (position 29993839)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNNTTCTTTTCAGTAAATGGATTGACAGGTTAAAGAGAGCAGGGATGT[T/A]GGRGCAGGTGTGTTGCGAGCAAGTACTCRTCCCGCTGGGTGTGTGCMMAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/almlmoyi