mapta

Ensembl ID:
ENSDARG00000089314
ZFIN ID:
ZDB-GENE-081027-1
Human Orthologue:
MAPT
Human Description:
microtubule-associated protein tau [Source:HGNC Symbol;Acc:6893]
Mouse Orthologue:
Mapt
Mouse Description:
microtubule-associated protein tau Gene [Source:MGI Symbol;Acc:MGI:97180]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41948 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22009 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121718 Essential Splice Site 50 392 1 10
Genomic Location:
Chromosome 12 (position 5197626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCATAAGGAGAATGGGCTCGTGAGACCAGGAGACTGTCCAATGAAAG[G/A]TGAGCTGCTTCTGTGGGAAAACAGGTTCAGTGTGTGACAGCCAGTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121718 Splice Site, Nonsense 293 392 9 10
Genomic Location:
Chromosome 12 (position 5236695)
KASP Assay ID:
2260-4875.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTGTTTAATTTGCTTTGAGTCATGAGGAATTTCCCCTTTTTAAGGT[G/T]GAGGAAACATTGAGATCAGGTCTGAGAAGCTTGATTTCAAGGCTCAGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link