mapta

Ensembl ID:
ENSDARG00000089314
ZFIN ID:
ZDB-GENE-081027-1
Human Orthologue:
MAPT
Human Description:
microtubule-associated protein tau [Source:HGNC Symbol;Acc:6893]
Mouse Orthologue:
Mapt
Mouse Description:
microtubule-associated protein tau Gene [Source:MGI Symbol;Acc:MGI:97180]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41948 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22009 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41948
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121718 Essential Splice Site 50 392 1 10
Genomic Location (Zv9):
Chromosome 12 (position 5197626)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4746638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCATAAGGAGAATGGGCTCGTGAGACCAGGAGACTGTCCAATGAAAG[G/A]TGAGCTGCTTCTGTGGGAAAACAGGTTCAGTGTGTGACAGCCAGTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121718 Splice Site, Nonsense 293 392 9 10
Genomic Location (Zv9):
Chromosome 12 (position 5236695)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4707569
KASP Assay ID:
2260-4875.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTGTTTAATTTGCTTTGAGTCATGAGGAATTTCCCCTTTTTAAGGT[G/T]GAGGAAACATTGAGATCAGGTCTGAGAAGCTTGATTTCAAGGCTCAGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link