gc

Ensembl ID:
ENSDARG00000089310
ZFIN ID:
ZDB-GENE-040718-307
Description:
vitamin D-binding protein [Source:RefSeq peptide;Acc:NP_001002568]
Human Orthologues:
AFM, AFP, ALB, GC
Human Descriptions:
afamin [Source:HGNC Symbol;Acc:316]
albumin [Source:HGNC Symbol;Acc:399]
alpha-fetoprotein [Source:HGNC Symbol;Acc:317]
group-specific component (vitamin D binding protein) [Source:HGNC Symbol;Acc:4187]
Mouse Orthologues:
5830473C10Rik, Afm, Afp, Alb, Gc
Mouse Descriptions:
afamin Gene [Source:MGI Symbol;Acc:MGI:2429409]
albumin Gene [Source:MGI Symbol;Acc:MGI:87991]
alpha fetoprotein Gene [Source:MGI Symbol;Acc:MGI:87951]
group specific component Gene [Source:MGI Symbol;Acc:MGI:95669]
RIKEN cDNA 5830473C10 gene Gene [Source:MGI Symbol;Acc:MGI:1923342]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33694 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126537 Nonsense 332 347 8 8
Genomic Location (Zv9):
Chromosome 5 (position 47282924)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 45097893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCCCATCAATCTCCAGACGTGGCAAATCCAGATTCATCCCAGCTCTG[C/A]GATGGAGCTCAACCACATGGGATTGACAGGTGCTTATTTAATATTCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link