LPHN1 (1 of 4)

Ensembl ID:
ENSDARG00000089292
Description:
latrophilin 1 [Source:HGNC Symbol;Acc:20973]
Human Orthologue:
LPHN1
Human Description:
latrophilin 1 [Source:HGNC Symbol;Acc:20973]
Mouse Orthologue:
Lphn1
Mouse Description:
latrophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1929461]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20133 Nonsense Mutation detected in F1 DNA During 2014
sa18767 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20133
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 144 1474 5 30
Genomic Location:
Chromosome 3 (position 48760990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCTCTCTTCCACATCTCCAGTCTTTGTATGTCCTGGGACTCTAT[T/A]AAGGGTGCAGGCAGCAAGTTTGCTGCAGGAGGCGGAGCATCAGTCGGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 962 1474 21 30
Genomic Location:
Chromosome 3 (position 48725570)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTTGAGAGCGAATACTCCCGGAAGAAATACTACTACCTTTGTGGCTA[C/A]TGCTTTCCAGCCCTGGTGGTGGGCATCTCAGCAGCCATCGACTACCGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Mortality among heart failure patients: Genomic variation associated with mortality among adults of European and African ancestry with heart failure: the cohorts for heart and aging research in genomic epidemiology consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9gsihp71