pcdh1a6

Ensembl ID:
ENSDARG00000089289
ZFIN ID:
ZDB-GENE-050203-2
Description:
protocadherin 1 alpha 6 [Source:RefSeq peptide;Acc:NP_001019272]
Human Orthologues:
PCDHA1, PCDHA10, PCDHA11, PCDHA12, PCDHA13, PCDHA2, PCDHA3, PCDHA4, PCDHA5, PCDHA6, PCDHA7, PCDHA8, PCDHA9
Human Descriptions:
protocadherin alpha 1 [Source:HGNC Symbol;Acc:8663]
protocadherin alpha 10 [Source:HGNC Symbol;Acc:8664]
protocadherin alpha 11 [Source:HGNC Symbol;Acc:8665]
protocadherin alpha 12 [Source:HGNC Symbol;Acc:8666]
protocadherin alpha 13 [Source:HGNC Symbol;Acc:8667]
protocadherin alpha 2 [Source:HGNC Symbol;Acc:8668]
protocadherin alpha 3 [Source:HGNC Symbol;Acc:8669]
protocadherin alpha 4 [Source:HGNC Symbol;Acc:8670]
protocadherin alpha 5 [Source:HGNC Symbol;Acc:8671]
protocadherin alpha 6 [Source:HGNC Symbol;Acc:8672]
protocadherin alpha 7 [Source:HGNC Symbol;Acc:8673]
protocadherin alpha 8 [Source:HGNC Symbol;Acc:8674]
protocadherin alpha 9 [Source:HGNC Symbol;Acc:8675]
Mouse Orthologue:
AC020968.2
Mouse Description:
protocadherin alpha-3 [Source:RefSeq peptide;Acc:NP_619603]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18005 Nonsense Available for shipment Available now
sa27594 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100596 Nonsense 54 767 2 2
Genomic Location (Zv9):
Chromosome 10 (position 21658390)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21619804
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGAGATAGTGAYTGGATCAAATAAGGAGTATTTTGACGTAAATCTT[A/T]AAACTGGTGTGCTGTTTGTTAATGGAAGAATTGACCGCGAGGAGTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100596 Nonsense 386 767 2 2
Genomic Location (Zv9):
Chromosome 10 (position 21659386)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21620800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACATCGTACAATAATCATTATTCTCTAGTGGTAGATGGACCTCTGGAC[A/T]GAGAGAGTGTTTCTCAGTATAACATCACTATTACAGCTGCAGATGAAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link