LOC100150722

Ensembl ID:
ENSDARG00000089276
Human Orthologue:
TMEM114
Human Description:
transmembrane protein 114 [Source:HGNC Symbol;Acc:33227]
Mouse Orthologues:
Gm12581, Tmem114
Mouse Descriptions:
predicted gene 12581 Gene [Source:MGI Symbol;Acc:MGI:3651706]
transmembrane protein 114 Gene [Source:MGI Symbol;Acc:MGI:1921970]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7365 Missense Mutation detected in F1 DNA During 2014
sa22155 Nonsense Available for shipment Available now
sa8897 Nonsense Mutation detected in F1 DNA During 2014
sa12002 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7365
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129501 Missense 17 200 1 4
Genomic Location:
Chromosome 12 (position 36895958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGAAAATCACATTYGGTTTCGTGGTGGTMKGCGGGGGTCTGACTGGTG[T/A]TCTCAGTTTCAGCTGTTTAGCGCTCGCCATTGGGACTGAATATTGGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22155
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129501 Nonsense 32 200 1 4
Genomic Location:
Chromosome 12 (position 36896004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGTTCTCAGTTTCAGCTGTTTAGCGCTCGCCATTGGGACTGAATATTG[G/A]TACATCATCGAAGACCAGCGCACGAACCACACTAACCCGGAGCGCAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129501 Nonsense 152 200 4 4
Genomic Location:
Chromosome 12 (position 36906818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTACTCTCAGAAGGCACTGGAAGAGACAGAGCGGCGAATGGGCAGAGAA[C/T]AGATGGCTCAGGTGCACACATCCTTCGGCTGGTCAATGGGAATGGCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129501 Nonsense 190 200 4 4
Genomic Location:
Chromosome 12 (position 36906933)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGTGAWGACTGGCCTTCTGCTGCTGCTGGCTGTCAAGCTGGTGCCTT[T/A]AACYCAATATGAAGACTCTGTTGCWCCCATATAGAGCAGATTTAACACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hvoondxi