LOC100004210

Ensembl ID:
ENSDARG00000089271
Human Orthologue:
KIAA2022
Human Description:
KIAA2022 [Source:HGNC Symbol;Acc:29433]
Mouse Orthologue:
C77370
Mouse Description:
expressed sequence C77370 Gene [Source:MGI Symbol;Acc:MGI:2148050]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33582 Nonsense Mutation detected in F1 DNA During 2016
sa33583 Nonsense Mutation detected in F1 DNA During 2016
sa18487 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128271 Nonsense 336 1044 1 2
Genomic Location:
Chromosome 5 (position 24796137)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCATCACCTGCTGTCGTCTGTCTGAGTCCAAATGCTCTCCTACACTA[T/A]GAGAGACTTGCACCGTTAAAAGCATACTGGCAGGCAAGAGAAAAAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128271 Nonsense 615 1044 1 2
Genomic Location:
Chromosome 5 (position 24796972)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTGAACCTAACCAGCCCATTTCATGGCCATCCCAACCATCTGCTGAC[C/T]AGTTGCCCTTCTCCCCAGACATCCCGACCCAGTCACCTATGATGCCATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128271 Nonsense 969 1044 2 2
Genomic Location:
Chromosome 5 (position 24798103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGTAGTGCCGCTGACCTTAAAAAGCGAGGAGGTGCCTCAGGYGGAGGT[C/T]GAGGGAAGAAAGGAGCTGGTCGTGGTAGTGGTAAAGCACTGCCTAAACTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link