ENSDARG00000089262

Ensembl ID:
ENSDARG00000089262
Human Orthologue:
PBX2
Human Description:
pre-B-cell leukemia homeobox 2 [Source:HGNC Symbol;Acc:8633]
Mouse Orthologue:
Pbx2
Mouse Description:
pre B-cell leukemia transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:1341793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20337 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20337
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100074 Nonsense 316 341 7 7
Genomic Location:
Chromosome 5 (position 5270724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCTTAACTTGGTGTTTTCTGTGTCTATTTACAGGGTAATGGCGTTTG[G/A]CATGATGCCGTCACTCCGTCATCAGTCACGTCTCCTATAGAGGGAACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Genome-wide association study identifies three new susceptibility loci for adult asthma in the Japanese population. (View Study)
  • Crohn's disease: A genome-wide association study identifies 2 susceptibility Loci for Crohn's disease in a Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gbojaabk