dus1l

Ensembl ID:
ENSDARG00000089260
ZFIN ID:
ZDB-GENE-030131-1435
Description:
tRNA-dihydrouridine synthase 1-like [Source:RefSeq peptide;Acc:NP_955911]
Human Orthologue:
DUS1L
Human Description:
dihydrouridine synthase 1-like (S. cerevisiae) [Source:HGNC Symbol;Acc:30086]
Mouse Orthologue:
Dus1l
Mouse Description:
dihydrouridine synthase 1-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915980]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31344 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113105 Essential Splice Site 360 496 10 14
ENSDART00000127028 Essential Splice Site 375 511 10 14
Genomic Location (Zv9):
Chromosome 3 (position 36228545)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36099829
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGGACTTCCCTTCCCACACTGGATCTGTCAGCCCTACGTCAGACCACC[G/A]TGAGTTTGAATATAATGTCACAATTATTTATTGATTGGTTTATTTGGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link