EYS

Ensembl ID:
ENSDARG00000089257
Description:
eyes shut homolog (Drosophila) [Source:HGNC Symbol;Acc:21555]
Human Orthologue:
EYS
Human Description:
eyes shut homolog (Drosophila) [Source:HGNC Symbol;Acc:21555]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9550 Essential Splice Site Available for shipment Available now
sa9409 Essential Splice Site Available for shipment Available now
sa9466 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9550
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124241 Essential Splice Site 462 472 10 10
ENSDART00000124241 Essential Splice Site 462 472 10 10
ENSDART00000124241 Essential Splice Site 462 472 10 10
Genomic Location:
Chromosome 13 (position 38080123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RAAGTTGAAATATTAGTTTTAGGGATCACTTCATATATAGAAAAAAAATK[A/T]ATGGGCCAATTTCAAATTGTAAATCTTTTGAAAAATACTGGGCTYTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124241 Essential Splice Site 462 472 10 10
ENSDART00000124241 Essential Splice Site 462 472 10 10
ENSDART00000124241 Essential Splice Site 462 472 10 10
Genomic Location:
Chromosome 13 (position 38080123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RAAGTTGAAATATTAGTTTTAGGGATCACTTCATATATAGAAAAAAAATK[A/T]ATGGGCCAATTTCAAATTGTAAATCTTTTGAAAAATACTGGGCTYTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124241 Essential Splice Site 462 472 10 10
ENSDART00000124241 Essential Splice Site 462 472 10 10
ENSDART00000124241 Essential Splice Site 462 472 10 10
Genomic Location:
Chromosome 13 (position 38080123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RAAGTTGAAATATTAGTTTTAGGGATCACTTCATATATAGAAAAAAAATK[A/T]ATGGGCCAATTTCAAATTGTAAATCTTTTGAAAAATACTGGGCTYTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zdmnteil