LOC100003678

Ensembl ID:
ENSDARG00000089255
Human Orthologue:
CD59
Human Description:
CD59 molecule, complement regulatory protein [Source:HGNC Symbol;Acc:1689]
Mouse Orthologues:
Cd59a, Cd59b
Mouse Descriptions:
CD59a antigen Gene [Source:MGI Symbol;Acc:MGI:109177]
CD59b antigen Gene [Source:MGI Symbol;Acc:MGI:1888996]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24607 Nonsense Mutation detected in F1 DNA During 2014
sa24606 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124971 Nonsense 42 132 2 3
Genomic Location:
Chromosome 25 (position 7946461)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTCTCCTCTGCAGGCTCGTCTCTGCGATGCTATAAGTGTGAGGATTA[C/A]GCTGGAGGACGATGCTCCGTTCAGCAGCCCTGCTCTTATGAGGACGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124971 Nonsense 94 132 3 3
Genomic Location:
Chromosome 25 (position 7943188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGCGATAACTCTCGCCTGTCTCAACAGTTTCCATCCATATCAGAGTA[T/G]ACGTACAGATGCTGTAACACAGACCTGTGTAACGGCGGCCCACTGACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/me80acb0