LOC100003678

Ensembl ID:
ENSDARG00000089255
Human Orthologue:
CD59
Human Description:
CD59 molecule, complement regulatory protein [Source:HGNC Symbol;Acc:1689]
Mouse Orthologues:
Cd59a, Cd59b
Mouse Descriptions:
CD59a antigen Gene [Source:MGI Symbol;Acc:MGI:109177]
CD59b antigen Gene [Source:MGI Symbol;Acc:MGI:1888996]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24607 Nonsense Available for shipment Available now
sa38003 Nonsense Mutation detected in F1 DNA During 2016
sa24606 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124971 Nonsense 42 132 2 3
Genomic Location (Zv9):
Chromosome 25 (position 7946461)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7558985
KASP Assay ID:
2261-9372.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTCTCCTCTGCAGGCTCGTCTCTGCGATGCTATAAGTGTGAGGATTA[C/A]GCTGGAGGACGATGCTCCGTTCAGCAGCCCTGCTCTTATGAGGACGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38003
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124971 Nonsense 79 132 3 3
Genomic Location (Zv9):
Chromosome 25 (position 7943233)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7555757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCTCCAGGTGGGAAGACCATTCGCCGGTGCATTCGATACACTGACTG[C/A]GATAACTCTCGCCTGTCTCAACAGTTTCCATCCATATCAGAGTATACGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24606
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124971 Nonsense 94 132 3 3
Genomic Location (Zv9):
Chromosome 25 (position 7943188)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 7555712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGCGATAACTCTCGCCTGTCTCAACAGTTTCCATCCATATCAGAGTA[T/G]ACGTACAGATGCTGTAACACAGACCTGTGTAACGGCGGCCCACTGACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link