LOC560573

Ensembl ID:
ENSDARG00000089236
Human Orthologue:
METT5D1
Human Description:
methyltransferase 5 domain containing 1 [Source:HGNC Symbol;Acc:26606]
Mouse Orthologue:
Mett5d1
Mouse Description:
methyltransferase 5 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1924144]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16002 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123463 Nonsense 379 410 5 5
Genomic Location:
Chromosome 7 (position 33476704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTTGAAGAGGAGGAAGAGGGTGACGAAGGAGGGAATAGTGTGCATTG[G/A]GTCAGTCTGAAGAAAGTGATAAAGCCAAGTGAAGAGGAGGTGCAGGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3wzbkmj9