LOC560573

Ensembl ID:
ENSDARG00000089236
Human Orthologue:
METT5D1
Human Description:
methyltransferase 5 domain containing 1 [Source:HGNC Symbol;Acc:26606]
Mouse Orthologue:
Mett5d1
Mouse Description:
methyltransferase 5 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1924144]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34105 Nonsense Mutation detected in F1 DNA During 2016
sa34106 Nonsense Mutation detected in F1 DNA During 2016
sa16002 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123463 Nonsense 220 410 4 5
Genomic Location:
Chromosome 7 (position 33456254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTACCCCGACATGCCCTGCGCCGCTGACGTGGTCAACGCCTTAGATCAA[C/T]AGGCGCTTGCGTCCGTGCTGGCCGCGTACGGGGAGGAGCGGCACACCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123463 Nonsense 318 410 5 5
Genomic Location:
Chromosome 7 (position 33476519)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTCATGCTGGCCTGCGTGTGGCCCAGACTCTGCTCCGTCCCAAAGGC[C/T]GACTCTGTGTTCTCACCTTCCACTCCCTGGAGGACCGTCTGACCAAACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123463 Nonsense 379 410 5 5
Genomic Location:
Chromosome 7 (position 33476704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTTGAAGAGGAGGAAGAGGGTGACGAAGGAGGGAATAGTGTGCATTG[G/A]GTCAGTCTGAAGAAAGTGATAAAGCCAAGTGAAGAGGAGGTGCAGGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link