si:ch211-244a17.4

Ensembl ID:
ENSDARG00000089235
ZFIN ID:
ZDB-GENE-030131-4270
Human Orthologue:
C21orf29
Human Description:
chromosome 21 open reading frame 29 [Source:HGNC Symbol;Acc:1268]
Mouse Orthologue:
C330046G03Rik
Mouse Description:
RIKEN cDNA C330046G03 gene Gene [Source:MGI Symbol;Acc:MGI:2671932]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41368 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34570 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122558 Essential Splice Site 616 666 None 12
ENSDART00000146535 Essential Splice Site 615 665 None 12
Genomic Location (Zv9):
Chromosome 9 (position 12874468)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12627033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACATTGCAATGAAGGTTTTGGAAAAAATGATGCATACATTTTTGTTTC[A/G]GATGGCAGGGTTACGAGGGCTTTGTCCCTGTCAACAGACTGAGCACCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122558 Nonsense 654 666 12 12
ENSDART00000146535 Nonsense 653 665 12 12
Genomic Location (Zv9):
Chromosome 9 (position 12874354)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 12626919
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAATTTTTCAACACAACCGACGGCTACTACCTCATCTACTCCAGTGCC[A/T]GAGCTGCTCTCTCTAAGGTCCTTAAATTAAGGACCATATAGTGGCACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link