CSGALNACT1 (2 of 2)

Ensembl ID:
ENSDARG00000089233
Description:
chondroitin sulfate N-acetylgalactosaminyltransferase 1 [Source:HGNC Symbol;Acc:24290]
Human Orthologue:
CSGALNACT1
Human Description:
chondroitin sulfate N-acetylgalactosaminyltransferase 1 [Source:HGNC Symbol;Acc:24290]
Mouse Orthologue:
Csgalnact1
Mouse Description:
chondroitin sulfate N-acetylgalactosaminyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2442354]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7623 Missense Mutation detected in F1 DNA During 2016
sa11541 Nonsense Available for shipment Available now
sa8459 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa7623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130358 Missense 39 412 1 7
Genomic Location (Zv9):
Chromosome 8 (position 704033)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 570633
KASP Assay ID:
554-4162.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGACCGGCTGGAGGACGAGTTTATGGTTCTGCCCTTYCAGAGMTTC[A/T]GTCTCCGCAGCGTCTGTCAGYTGGAGACCGGCCTYAGCAGACGACCARAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130358 Nonsense 44 412 1 7
Genomic Location (Zv9):
Chromosome 8 (position 704050)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 570650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGAGTTTATGGTTCTGCCCTTYCAGAGMTTCWGTCTCCGCAGCGTCTG[T/A]CAGYTGGAGACCGGCCTYAGCAGACGACCARAGRAGGCAGAGCTCAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8459
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130358 Essential Splice Site 295 412 5 7
Genomic Location (Zv9):
Chromosome 8 (position 711067)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 577667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCAGAACTCCTCTACGGCCAGCACGTTCCTCCTGCTCAACAGCAGATG[G/A]TAAGAGCTCTTAAAGTCACTGTCAGCAGCCATGCTTCCATCCAAAGATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link