RNF31 (1 of 3)

Ensembl ID:
ENSDARG00000089229
Description:
ring finger protein 31 [Source:HGNC Symbol;Acc:16031]
Human Orthologue:
RNF31
Human Description:
ring finger protein 31 [Source:HGNC Symbol;Acc:16031]
Mouse Orthologue:
Rnf31
Mouse Description:
ring finger protein 31 Gene [Source:MGI Symbol;Acc:MGI:1934704]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19780 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19780
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124141 Essential Splice Site 254 359 8 11
Genomic Location (Zv9):
Chromosome 2 (position 27843322)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 28157900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAATTTGTCCTCCACAAAAAAGACGGTCTCTGATTCTTCTTCAGTAGT[T/A]AAGTGTAATGACCCAAGCATGCTGGACCCAGGTGAGGATGCTCCAAACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link