CXorf38 (2 of 2)

Ensembl ID:
ENSDARG00000089227
Description:
chromosome X open reading frame 38 [Source:HGNC Symbol;Acc:28589]
Human Orthologue:
CXorf38
Human Description:
chromosome X open reading frame 38 [Source:HGNC Symbol;Acc:28589]
Mouse Orthologue:
1810030O07Rik
Mouse Description:
RIKEN cDNA 1810030O07 gene Gene [Source:MGI Symbol;Acc:MGI:1916405]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8061 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5108 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa8061
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123590 Essential Splice Site 870 1162 None 20
Genomic Location:
Chromosome 25 (position 28503038)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGTTCTGTAGCCTCAATGAGRAAAAAGCCCAGGATTGATTGTCCAGG[T/C]AAAGACRATGTTCTTTTTGTAARTGGGCACAGYAACATAAAAATAAAAAW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5108
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123590 Essential Splice Site 987 1162 None 20
Genomic Location:
Chromosome 25 (position 28502049)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGTTCACTAAAGAACATAAATTACACAGTTGACTATGACGGAGAAGG[T/G]TAGTATTTTTGTCTGATGTCACAATAACTGGTAYTTRTTTAAAAGTTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/itpjorxu