CXorf38 (2 of 2)

Ensembl ID:
ENSDARG00000089227
Description:
chromosome X open reading frame 38 [Source:HGNC Symbol;Acc:28589]
Human Orthologue:
CXorf38
Human Description:
chromosome X open reading frame 38 [Source:HGNC Symbol;Acc:28589]
Mouse Orthologue:
1810030O07Rik
Mouse Description:
RIKEN cDNA 1810030O07 gene Gene [Source:MGI Symbol;Acc:MGI:1916405]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44323 Nonsense Mutation detected in F1 DNA During 2016
sa39486 Nonsense Mutation detected in F1 DNA During 2016
sa44322 Nonsense Mutation detected in F1 DNA During 2016
sa5108 Essential Splice Site F2 line generated During 2016
sa38092 Nonsense Mutation detected in F1 DNA During 2016
sa44321 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123590 Nonsense 167 1162 4 20
Genomic Location (Zv9):
Chromosome 25 (position 28531530)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27221624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTATTAAGGTAATAAATGTACGGAACAATGTGATGCACTCCCCTGACT[T/G]AAAAATGAGCAACGAGGACATGAAAAAGCATCATAGCACAATTCTACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123590 Nonsense 391 1162 8 20
Genomic Location (Zv9):
Chromosome 25 (position 28525266)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27215360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATGACAAAAAGGGTGCCCATCAGGAGGTAGCATGCATTGCCCTTGAA[C/T]AGATGAAATCACAGGAAGAAAGCACGAATGAACCATCCAGTTCTGTTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123590 Nonsense 553 1162 11 20
Genomic Location (Zv9):
Chromosome 25 (position 28521805)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27211899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCAATATCAGAAACGGAAAAGAACTTCAAAGGAATTCTGAAGGAGTG[T/A]CTTGAGACAAGGGGTCTCAAAAGTCCCAACTATACCACTGTGAATAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5108
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123590 Essential Splice Site 987 1162 None 20
Genomic Location (Zv9):
Chromosome 25 (position 28502049)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27192143
KASP Assay ID:
554-3534.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGTTCACTAAAGAACATAAATTACACAGTTGACTATGACGGAGAAGG[T/G]TAGTATTTTTGTCTGATGTCACAATAACTGGTAYTTRTTTAAAAGTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38092
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123590 Nonsense 1056 1162 18 20
Genomic Location (Zv9):
Chromosome 25 (position 28500009)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27190103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTTTCCCTGGTTGTTATGAACAAGGCCTGTGTCCAGCTGTCTTTCTG[T/A]GACTATACAATGAAGTGCACATGCCAAAGTACGAAGAAAGCAGCTCGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123590 Nonsense 1065 1162 18 20
Genomic Location (Zv9):
Chromosome 25 (position 28499984)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27190078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCCTGTGTCCAGCTGTCTTTCTGTGACTATACAATGAAGTGCACATGC[C/T]AAAGTACGAAGAAAGCAGCTCGAAATCATCTCAGTGCACGAATACTGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link