LOC564006

Ensembl ID:
ENSDARG00000089221
Human Orthologues:
SPECC1, SPECC1L
Human Descriptions:
sperm antigen with calponin homology and coiled-coil domains 1 [Source:HGNC Symbol;Acc:30615]
sperm antigen with calponin homology and coiled-coil domains 1-like [Source:HGNC Symbol;Acc:29022]
Mouse Orthologues:
Specc1, Specc1l
Mouse Descriptions:
sperm antigen with calponin homology and coiled-coil domains 1 Gene [Source:MGI Symbol;Acc:MGI:24423
sperm antigen with calponin homology and coiled-coil domains 1-like Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42938 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122790 Nonsense 375 482 8 11
Genomic Location (Zv9):
Chromosome 17 (position 24723849)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24877291
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGGATGCAGGAGGATTTCCCATCAGGACTCAGGTCGCTGAGGCTTCAT[G/T]GAGGCTCCAGGCGGAACTCCCTGCTTCGCTGGTGCCAATGCAGAACTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link