LOC100330779

Ensembl ID:
ENSDARG00000089216
Human Orthologue:
CYTL1
Human Description:
cytokine-like 1 [Source:HGNC Symbol;Acc:24435]
Mouse Orthologue:
Cytl1
Mouse Description:
cytokine-like 1 Gene [Source:MGI Symbol;Acc:MGI:2684993]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24030 Nonsense Mutation detected in F1 DNA During 2014
sa24029 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126480 Nonsense 27 162 1 4
Genomic Location:
Chromosome 21 (position 41281571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTGTGCGCGTGTTATATAAAAGCAGCGCTCAGAGTGTGTGTTTACAG[C/T]GAGCAGACAGAATGCTATTCTACGCACTGCTGGTTCTCGGGATGCCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126480 Essential Splice Site 144 162 4 4
Genomic Location:
Chromosome 21 (position 41276005)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTATCTTTACATTGTTATGAGGAAATCCTAACGCTGTGTATTTGTTTC[A/G]GGAATTGGTTTTCACTCATGATAACTGTGAAGCTTTGCACCGCAGACCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sbqlj01v