ADAM15

Ensembl ID:
ENSDARG00000089213
Description:
ADAM metallopeptidase domain 15 [Source:HGNC Symbol;Acc:193]
Human Orthologue:
ADAM15
Human Description:
ADAM metallopeptidase domain 15 [Source:HGNC Symbol;Acc:193]
Mouse Orthologue:
Adam15
Mouse Description:
a disintegrin and metallopeptidase domain 15 (metargidin) Gene [Source:MGI Symbol;Acc:MGI:1333882]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17218 Essential Splice Site Available for shipment Available now
sa32095 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36161 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127753 Essential Splice Site 60 975 1 25
Genomic Location:
Chromosome 16 (position 30937464)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTCACACCGCAGCCGGACGCGCGCATAACTCATTCCTCACACAACGG[T/A]ACGGGACAGAACACTCCGCTTTGTTTTTGTTRTGAAGCAACAGTTGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127753 Essential Splice Site 612 975 15 25
Genomic Location:
Chromosome 16 (position 30910257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAACTGTGGTCAGATGCCCAATGGTTCCTACATCCCCTGTTTGAAATG[G/A]TAAGAGAATGTTCTCTAATGTTCTCTTTGCTTGTGTGTGTGTTTTTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127753 Nonsense 737 975 18 25
Genomic Location:
Chromosome 16 (position 30906872)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACTGCAGATACTCTGGAAATGGAGGAAGTGTGGACAGCGGACCTGCA[C/T]AAGAACCCAGAGGTACAACACACATACACACACACAAACACACACACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link