ADAM15

Ensembl ID:
ENSDARG00000089213
Description:
ADAM metallopeptidase domain 15 [Source:HGNC Symbol;Acc:193]
Human Orthologue:
ADAM15
Human Description:
ADAM metallopeptidase domain 15 [Source:HGNC Symbol;Acc:193]
Mouse Orthologue:
Adam15
Mouse Description:
a disintegrin and metallopeptidase domain 15 (metargidin) Gene [Source:MGI Symbol;Acc:MGI:1333882]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17218 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127753 Essential Splice Site 60 975 1 25
Genomic Location:
Chromosome 16 (position 30937464)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTCACACCGCAGCCGGACGCGCGCATAACTCATTCCTCACACAACGG[T/A]ACGGGACAGAACACTCCGCTTTGTTTTTGTTRTGAAGCAACAGTTGCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jk7dt01m