ENSDARG00000089205

Ensembl ID:
ENSDARG00000089205
Human Orthologues:
RDH11, RDH12
Human Descriptions:
retinol dehydrogenase 11 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:17964]
retinol dehydrogenase 12 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:19977]
Mouse Orthologues:
Rdh11, Rdh12
Mouse Descriptions:
retinol dehydrogenase 11 Gene [Source:MGI Symbol;Acc:MGI:102581]
retinol dehydrogenase 12 Gene [Source:MGI Symbol;Acc:MGI:1925224]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25212 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126928 Nonsense 225 314 7 8
Genomic Location:
Chromosome 24 (position 19019993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAGATTATTATAATTTTTTCTGTGGTAGAGCTGGGAGTGAGGGTTTA[T/A]GCTGTGGATCCAGGCCTGGTGAATACAGATATCACCAGACATTTGATGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4erdbbbs