ENSDARG00000089192

Ensembl ID:
ENSDARG00000089192
Mouse Orthologue:
Slc7a15
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 15 Gene [Source:MGI Sym

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13935 Essential Splice Site Available for shipment Available now
sa36530 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128764 Essential Splice Site 320 467 3 6
Genomic Location (Zv9):
Chromosome 17 (position 50063687)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49437374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAGTGGAGGACGAGTRTGTTACGTTGCAGCAAGAGAGGGCCATATGG[T/C]AAGAAAGTGTATTTGARGAYAACAGGAAACNNTATTGGGTTAAAATAGTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128764 Essential Splice Site 362 467 4 6
Genomic Location (Zv9):
Chromosome 17 (position 50063360)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 49437047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGTTCTCATTCCCGGGGACTTCCAGGCAATAGTCAACTTTTTAAGG[T/G]ACTGCGCCTTATTTGGATAAAACTTTCTGCAAAATCCATCTATGTACTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link