TANC1 (1 of 2)

Ensembl ID:
ENSDARG00000089190
Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29364]
Human Orthologue:
TANC1
Human Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29364]
Mouse Orthologue:
Tanc1
Mouse Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16174 Nonsense Available for shipment Available now
sa21607 Nonsense Mutation detected in F1 DNA During 2014
sa13313 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16174
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114222 Nonsense 278 1683 6 24
Genomic Location:
Chromosome 9 (position 53642892)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
STGCAGCGACGAGCTCCACTAAGCTGGAGGATCTCAGTTTTCTTGATGAA[C/T]AGCGAAACACCCCCCTGCGCACCTCCATCCGCCTGCCCTGGCACAACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21607
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114222 Nonsense 308 1683 7 24
Genomic Location:
Chromosome 9 (position 53636481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGAGTAACCCTGTGCTGTACATGTTTTGCAGCTTGCTTTGCTCCGTA[C/A]AAGCCCACCGACATCATGCTTAAGCCGCTGCTGTTTGAGGTTCCCAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114222 Nonsense 682 1683 11 24
Genomic Location:
Chromosome 9 (position 53590479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAGAGCGCCAGCTATAAAGTAGTGCCCGTGWCTCTCTCTGAGCTCTA[T/A]CTGYTGCAGTGCAAMATGAAGTTTCTGAGTAACTCKGCGTTTGAGCGGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0bhnxmo4