si:ch211-153a8.3

Ensembl ID:
ENSDARG00000089187
ZFIN ID:
ZDB-GENE-090313-47
Human Orthologues:
SLPI, WFDC2, WFDC3, WFDC5
Human Descriptions:
secretory leukocyte peptidase inhibitor [Source:HGNC Symbol;Acc:11092]
WAP four-disulfide core domain 2 [Source:HGNC Symbol;Acc:15939]
WAP four-disulfide core domain 3 [Source:HGNC Symbol;Acc:15957]
WAP four-disulfide core domain 5 [Source:HGNC Symbol;Acc:20477]
Mouse Orthologues:
Slpi, Wap, Wfdc2, Wfdc3, Wfdc5
Mouse Descriptions:
secretory leukocyte peptidase inhibitor Gene [Source:MGI Symbol;Acc:MGI:109297]
WAP four-disulfide core domain 2 Gene [Source:MGI Symbol;Acc:MGI:1914951]
WAP four-disulfide core domain 3 Gene [Source:MGI Symbol;Acc:MGI:1923897]
WAP four-disulfide core domain 5 Gene [Source:MGI Symbol;Acc:MGI:2384800]
whey acidic protein Gene [Source:MGI Symbol;Acc:MGI:98943]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15938 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124091 Nonsense 73 168 2 4
Genomic Location (Zv9):
Chromosome 23 (position 12528618)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 12487420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGTTCAGGAGGACATAAGYGCTGTGTGTTTGACTGTGGAGCTGTGTG[T/A]GTCCCACCAGCTTTCAGTGAGTCTGATTCAACACACACTTCACTACTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link