A5PLF6_DANRE

Ensembl ID:
ENSDARG00000089181
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A5PLF6]
Human Orthologue:
ADAD1
Human Description:
adenosine deaminase domain containing 1 (testis-specific) [Source:HGNC Symbol;Acc:30713]
Mouse Orthologue:
Adad1
Mouse Description:
adenosine deaminase domain containing 1 (testis specific) Gene [Source:MGI Symbol;Acc:MGI:103258]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14397 Nonsense Available for shipment Available now
sa42324 Nonsense Mutation detected in F1 DNA During 2016
sa8812 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127477 Nonsense 85 575 3 12
Genomic Location (Zv9):
Chromosome 14 (position 1252630)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1229204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCAGATTCAAAGCCGAAGATTCTTCCCCGTGAGTTGATTGACAGATA[T/A]AAGCGTGGAGATACTCACCCGGTGTCAGCGTTGTACCAGCTCTCACAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127477 Nonsense 329 575 8 12
Genomic Location (Zv9):
Chromosome 14 (position 1266425)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1242999
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCTTCAAAAATCACATCACTCTGCATCTGTACCTGAGCCAGCTGCCC[A/T]AAGGAGCATCACAGATCCCGTCTCAGCTGTAAACACACACTAACAGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127477 Essential Splice Site 538 575 11 12
Genomic Location (Zv9):
Chromosome 14 (position 1272419)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1248993
KASP Assay ID:
2260-7116.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCCCAGAGAGAGGAGCTGCTCACTGCTGTCACCTACAGAGAAGCCAAG[G/T]TACTGCACGCTGCCTTATTTACAGCACRCACATGAAGAGCTGAATCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link