A5PLF6_DANRE

Ensembl ID:
ENSDARG00000089181
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A5PLF6]
Human Orthologue:
ADAD1
Human Description:
adenosine deaminase domain containing 1 (testis-specific) [Source:HGNC Symbol;Acc:30713]
Mouse Orthologue:
Adad1
Mouse Description:
adenosine deaminase domain containing 1 (testis specific) Gene [Source:MGI Symbol;Acc:MGI:103258]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14397 Nonsense Available for shipment Available now
sa8812 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14397
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127477 Nonsense 85 575 3 12
Genomic Location:
Chromosome 14 (position 1252630)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCAGATTCAAAGCCGAAGATTCTTCCCCGTGAGTTGATTGACAGATA[T/A]AAGCGTGGAGATACTCACCCGGTGTCAGCGTTGTACCAGCTCTCACAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127477 Essential Splice Site 538 575 11 12
Genomic Location:
Chromosome 14 (position 1272419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCCCAGAGAGAGGAGCTGCTCACTGCTGTCACCTACAGAGAAGCCAAG[G/T]TACTGCACGCTGCCTTATTTACAGCACRCACATGAAGAGCTGAATCTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wj1ylmyt