ERBB4 (3 of 5)

Ensembl ID:
ENSDARG00000089167
Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) [Source:HGNC Symbol;Acc:3432]
Human Orthologue:
ERBB4
Human Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) [Source:HGNC Symbol;Acc:3432]
Mouse Orthologue:
Erbb4
Mouse Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) Gene [Source:MGI Symbol;Acc:MGI:104

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3351 Nonsense Mutation detected in F1 DNA During 2014
sa24834 Nonsense Mutation detected in F1 DNA During 2014
sa6573 Nonsense Mutation detected in F1 DNA During 2014
sa19414 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Nonsense 58 609 1 15
Genomic Location:
Chromosome 1 (position 6280286)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTRGCCATCTTTCTCAACTACAGACGAGACGGCTACTTCGGCCTGAGA[C/T]AGCTCGGCCTCAGGAACCTGACAGGTATAGTTGTCGGTTTATATCAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Nonsense 150 609 4 15
Genomic Location:
Chromosome 1 (position 6247146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAAGACGGTGTGTGCGGAGCAGTGTGACGGTCGATGTTTTGGACCGTA[T/G]GTCAGTAACTGCTGTCACCGTGAATGTGCAGGGGGCTGTTTCGGACCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Nonsense 371 609 10 15
Genomic Location:
Chromosome 1 (position 6238826)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGTGGTATTTCTCTGCTGATCCTRAAGCAGCGCTGGATCACGTCTCTG[C/T]AGTTTCAGTCTCTGAGAGAGATCAGCGCYGGTAACGTCTACATGACCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19414
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Essential Splice Site 498 609 13 15
Genomic Location:
Chromosome 1 (position 6220652)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTCAACAAGTTAAGTGTCATTCTCCTGTATTCTGTTTTCATGTTTT[A/G]GGGACCAGATCACTGTGTGAAGTGTCTGCATCTCAAAGACGGGCCCAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9hldgmpd