IL17RA (4 of 4)

Ensembl ID:
ENSDARG00000089153
Description:
interleukin 17 receptor A [Source:HGNC Symbol;Acc:5985]
Human Orthologue:
IL17RA
Human Description:
interleukin 17 receptor A [Source:HGNC Symbol;Acc:5985]
Mouse Orthologue:
Il17ra
Mouse Description:
interleukin 17 receptor A Gene [Source:MGI Symbol;Acc:MGI:107399]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24666 Nonsense Mutation detected in F1 DNA During 2014
sa13496 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127168 Nonsense 164 420 4 4
Genomic Location:
Chromosome 25 (position 20544882)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGCTCAGCACAATCGGCAGAATTCAATGGCTGGATATGCAAAGGGAA[C/T]GAATCGCCAAGTCCTCTGATAAAGTCCTGATTCTGTGCTCTCCGGGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127168 Nonsense 292 420 4 4
Genomic Location:
Chromosome 25 (position 20544498)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAATSCATTGAAGGCATTWGGGAGAAYGATTACTTCTGCTGTCCGTCA[G/T]GACGAGCCCTTCGGGATGCAATTGAGGWGTTTCGAAAYTACCAGGTGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9usi5rj2