tlr8a

Ensembl ID:
ENSDARG00000089151
ZFIN ID:
ZDB-GENE-040219-13
Description:
Toll-like receptor 8a [Source:UniProtKB/TrEMBL;Acc:Q6TQH5]
Human Orthologue:
TLR8
Human Description:
toll-like receptor 8 [Source:HGNC Symbol;Acc:15632]
Mouse Orthologue:
Tlr8
Mouse Description:
toll-like receptor 8 Gene [Source:MGI Symbol;Acc:MGI:2176887]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24828 Nonsense Mutation detected in F1 DNA During 2014
sa24827 Nonsense Mutation detected in F1 DNA During 2014
sa24826 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110194 Nonsense 475 1020 1 2
Genomic Location:
Chromosome Zv9_NA586 (position 12020)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTCGTTAAGTCAGAATGCTACAATGCCGGCCGTGTGCTGGATCTCAGT[C/T]GAAATAACCTGTTTTTAATTTCTCCTGAACAATTTGACACATACGGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24827
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110194 Nonsense 574 1020 1 2
Genomic Location:
Chromosome Zv9_NA586 (position 11722)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAACCCACAACATGATGTTTCTTCAATATCTGCCCTCACTGAAGGTGT[T/A]GAACATGAGCTTTAATAGCATCAACACGTTAACAACCAAAACCATGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110194 Nonsense 659 1020 1 2
Genomic Location:
Chromosome Zv9_NA586 (position 11468)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATACGCAACTTCCCATTACTATTCAACGCTTGCAAATGAGCCACAAT[C/T]AGCTTGCAAACATTAACTGGACAATGTTGAGGCGTTTCCAGAATCTCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zsfa3byc