IL17REL

Ensembl ID:
ENSDARG00000089131
Description:
interleukin 17 receptor E-like [Source:HGNC Symbol;Acc:33808]
Human Orthologue:
IL17REL
Human Description:
interleukin 17 receptor E-like [Source:HGNC Symbol;Acc:33808]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38106 Nonsense Available for shipment Available now
sa24704 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130410 Nonsense 48 445 2 16
Genomic Location (Zv9):
Chromosome 25 (position 30464637)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29031998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCAGTGTGTGCCGATTCTGCAGGAATGATTGGACATTGCCAGATTTA[T/G]ACATTCGGCCGAGTTGGTGGTTTCAATGTCACAGGAAAACAGGTAAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24704
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130410 Nonsense 313 445 11 16
Genomic Location (Zv9):
Chromosome 25 (position 30478928)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29046289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAAGATGGCATTTAAAGATGGTCAGCAATGGGCAGAGATATCAGCGT[G/A]GGTGAAAGCCAACTTCTCCGTTTCCATCTGTGAGATGAAACCTTCTCAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Genome-wide association study for ulcerative colitis identifies risk loci at 7q22 and 22q13 (IL17REL). (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link