LOC100007048

Ensembl ID:
ENSDARG00000089109
Human Orthologue:
BCL2
Human Description:
B-cell CLL/lymphoma 2 [Source:HGNC Symbol;Acc:990]
Mouse Orthologue:
Bcl2
Mouse Description:
B-cell leukemia/lymphoma 2 Gene [Source:MGI Symbol;Acc:MGI:88138]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10446 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130300 Nonsense 174 209 2 2
Genomic Location:
Chromosome 2 (position 12980188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTCTCTCTCTCTATCACTAGGAAGCATTTGTGGAGCTCTACAGCAGC[C/T]AGAGGGATTCTGTGTTTCACAGTTCATGGTCATCAATAGTAACRGTCTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2uv0wfc4