plrdgb

Ensembl ID:
ENSDARG00000089101
ZFIN ID:
ZDB-GENE-000406-3
Description:
PITP-less RdgB-like protein [Source:RefSeq peptide;Acc:NP_571650]
Human Orthologue:
PITPNM1
Human Description:
phosphatidylinositol transfer protein, membrane-associated 1 [Source:HGNC Symbol;Acc:9003]
Mouse Orthologue:
Pitpnm1
Mouse Description:
phosphatidylinositol transfer protein, membrane-associated 1 Gene [Source:MGI Symbol;Acc:MGI:1197524

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43707 Nonsense Mutation detected in F1 DNA During 2017
sa39344 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126531 Nonsense 410 543 12 14
ENSDART00000147718   None 68 None 2
Genomic Location (Zv9):
Chromosome 21 (position 38686423)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39826654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAATCTGTTTTACCCATCGGACCCCTCTGCCTCACGCCTGGAGCCAT[T/A]ATTGCACTCAGTTCTCACCCAGTTGCCTCCTTTTCCTGTTCCCCGGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126531 Essential Splice Site 493 543 13 14
ENSDART00000147718   None 68 None 2
Genomic Location (Zv9):
Chromosome 21 (position 38708833)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39849064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGCTCTGAGGGCACTGCCCCGAGCGAGCCTGTTAGCATCTCACAAGG[T/C]GAGTCTCCAGAGCACCAAATGTCCTTGAATCGGCTGCTTTCAGGCTCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link