ENSDARG00000089100

Ensembl ID:
ENSDARG00000089100
Mouse Orthologue:
Ofcc1
Mouse Description:
orofacial cleft 1 candidate 1 Gene [Source:MGI Symbol;Acc:MGI:2658851]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24796 Nonsense Mutation detected in F1 DNA During 2016
sa38185 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125114 Nonsense 38 345 2 8
Genomic Location (Zv9):
Chromosome Zv9_NA372 (position 201232)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 8164893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATTGTGGGCAGATTTTGGTTGGGAGCACACACAGTGGATCTAGTCTA[T/A]CAGGGTTCGCTGTTGACTACCCTGGAGGAGGTTCTGGTGGTGCTGCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125114 Nonsense 79 345 2 8
Genomic Location (Zv9):
Chromosome Zv9_NA372 (position 201110)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 8164771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGCTACTGCTGCTCCTGATCAGATGGGGCTGTCAGCTAGTGTTTGGCT[C/A]ACCGCCCTCTTTCCTGTCAAAGTTTATCATGGCTGCGGCAGCGTGGACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link