si:ch211-160j14.3

Ensembl ID:
ENSDARG00000089078
ZFIN ID:
ZDB-GENE-091204-86
Human Orthologue:
COL23A1
Human Description:
collagen, type XXIII, alpha 1 [Source:HGNC Symbol;Acc:22990]
Mouse Orthologue:
Col23a1
Mouse Description:
collagen, type XXIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2653243]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18363 Essential Splice Site Available for shipment Available now
sa43681 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43680 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123419 Essential Splice Site 72 285 4 17
ENSDART00000147387   None 235 None 14
Genomic Location (Zv9):
Chromosome 21 (position 30865440)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32064910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATTCTCAGAAACTGATGATTTTGCTGTTCGTTTCAAAGCTCTGCAG[G/A]TACATTTTTCAACCAAAGATCTTCRACSGTGCACYTGAAGGCCCACTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123419 Essential Splice Site 100 285 7 17
ENSDART00000147387 Essential Splice Site 28 235 3 14
Genomic Location (Zv9):
Chromosome 21 (position 30864922)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32064392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACTCATTCAGACACCTTTACTGCATAATGTAATGTGTTATCTTATCT[A/T]GGGCCAAAAGGGAGAGAGAGGTGATGTTGGGGAGCCTGGAGCAGCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123419 Essential Splice Site 172 285 10 17
ENSDART00000147387 Essential Splice Site 100 235 6 14
Genomic Location (Zv9):
Chromosome 21 (position 30864423)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32063893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCTTCTTCCAAATATTCCAGGGATATCATGGACTGCCTGGATCCAAG[G/A]TGGGTTCTGTGGGTGAAACTGTGAAACGCTTTTGTAAAGAAAAAATGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link